Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-4826_86

[Submit comment/correction]

Sequence	GENE-4826_86
Contig	7AS_4251750
Species	Triticum aestivum
Probe	GENE-4826_86
DNA Homology	7AS_4251750 Best IWGSC match 128 1e-27 URGI_Best IWGSC_N
BLAST, e-value	1e-27 7AS_4251750 Best IWGSC match
DNA	cggyatcggtcgacggagaagccgatggyggagcgagggatgMaggctag ggttagggtttgctgcttacgagaactcggagaggaccttgac

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.