Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c99286_60

[Submit comment/correction]

Sequence	RAC875_c99286_60
Contig	3AS_3362123
Probe	RAC875_c99286_60
DNA Homology	3AS_3362123 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 3AS_3362123 Best IWGSC match
DNA	gcagattaaggtcagaggaagcatctgctacgaggaacatcttcgtcttc Racctacaggtggaatatgcagagcaagcacgggcgtgcatccgtgccgc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.