Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 6AS_2017191

[Submit comment/correction]

Sequence	wsnp_Ex_c32765_41369642
Contig	6AS_2017191
Probe	wsnp_Ex_c32765_41369642
DNA Homology	6AS_2017191 Best IWGSC match 182 2.99878e-43 URGI_Best IWGSC_N
BLAST, e-value	2.99878e-43 6AS_2017191 Best IWGSC match
DNA	ttccagagagatcgcgggggaggaggatgatgggagggcgcgcggtgctc ctgctggtgatctcggcgctgttcgcgcagatcggcgcgtcggatccgct Rttccacgagtccttcaacgagagcttcgacgggagctggatcgtgtccg gcaaggaggagtataaaggtgtatggaagcacgcaaagagtgatggccat g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.