Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IACX6453

[Submit comment/correction]

Sequence	IACX6453
Contig	6AS_4363667
Probe	IACX6453
DNA Homology	6AS_4363667 Best IWGSC match 219 0 URGI_Best IWGSC_N
BLAST, e-value	0 6AS_4363667 Best IWGSC match
DNA	acatcacataaccctacagatcataacacccgagcaacccacagatctga gcaacagggaaccgaaagggaaatagcaacagaggagagatgcagcgacg Rggagagaagaactccggct

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.