Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c58253_127

[Submit comment/correction]

Sequence	RAC875_c58253_127
Contig	6AS_4421904
Probe	RAC875_c58253_127
DNA Homology	6AS_4421904 Best IWGSC match 174 1.99993e-41 URGI_Best IWGSC_N
BLAST, e-value	1.99993e-41 6AS_4421904 Best IWGSC match
DNA	aatgaagaaggaggcggtgagcatgaggccgacggcgaccgtgaggacgg Mcagagcggggtaccaggccaccggcagcgggctcgagatcgacgccatt c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.