Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ku_c3354_6228863

[Submit comment/correction]

Sequence	wsnp_Ku_c3354_6228863
Contig	6BL_4341958
Probe	wsnp_Ku_c3354_6228863
DNA Homology	6BL_4341958 Best IWGSC match 279 0 URGI_Best IWGSC_N
BLAST, e-value	0 6BL_4341958 Best IWGSC match
DNA	aggcattgcatctaccaaacgtgaaccaccacttcttctgatacttatgc tagggagggatgagtccaacaatgcagaactctgcaaagaaaggtgatcc Raagcaggcgcagcaagcggtatatgaggatcacgagaggatggaggatc aactccaagatccaagcttgttgagcgcacagctgagaaattttgcctgc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.