Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TA003858-0637

[Submit comment/correction]

Sequence	TA003858-0637
Contig	6AL_5764995
Probe	TA003858-0637
DNA Homology	6AL_5764995 Best IWGSC match 94 2e-17 URGI_Best IWGSC_N
BLAST, e-value	2e-17 6AL_5764995 Best IWGSC match
DNA	caagtgtagcacatttcagctgcagaacagcaactgaagcctaactatac R

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.