Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BS00078213_51

[Submit comment/correction]

Sequence	BS00078213_51
Contig	6AL_5742464
Probe	BS00078213_51
DNA Homology	6AL_5742464 Best IWGSC match 106 7e-21 URGI_Best IWGSC_N
BLAST, e-value	7e-21 6AL_5742464 Best IWGSC match
DNA	cgccccgggcacgcacgcacaagcgaaggcgccaacgatccgaggagcat Mttcttgcgcaatgagatcagggagcaccccatggctgcgggcggcgctg c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.