Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-3965_8

[Submit comment/correction]

Sequence	GENE-3965_8
Contig	6AL_4488540
Probe	GENE-3965_8
DNA Homology	6AL_4488540 Best IWGSC match 104 1e-20 URGI_Best IWGSC_N
BLAST, e-value	1e-20 6AL_4488540 Best IWGSC match
DNA	gctggtaaatccaagcagattgtctcagttccaccatcgacctctcgctc Macagtag

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.