Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ra_c39433_47141896

[Submit comment/correction]

Sequence	wsnp_Ra_c39433_47141896
Contig	6DL_109220
Probe	wsnp_Ra_c39433_47141896
DNA Homology	6DL_109220 Best IWGSC match 165 3e-38 URGI_Best IWGSC_N
BLAST, e-value	3e-38 6DL_109220 Best IWGSC match
DNA	ggatgtcgtccttgcgcacaaagttgatcgccacacccttgcgcccgaaa cgcccagagcgaccaatacgatggatgtaaagctcacggttgttggggag Rtcgtaattaatgacaagagagacctgctggacatccagccctcgagccc aaacatcggttgtgatcagaacacgggtcatgccacccctgaactcactc a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.