Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_s111939_66

[Submit comment/correction]

Sequence	RAC875_s111939_66
Contig	6AS_4368825
Probe	RAC875_s111939_66
DNA Homology	6AS_4368825 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 6AS_4368825 Best IWGSC match
DNA	ccctcgagtggggtgagtactttgaatacaagcggggtaacagacgctgc Rgatgacgatttgcccagtgtgatgacatgtgccaattatctcaaactac c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.