Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c26035_1037

[Submit comment/correction]

Sequence	RAC875_c26035_1037
Contig	6DS_2061905
Probe	RAC875_c26035_1037
DNA Homology	6DS_2061905 Best IWGSC match 135 9e-30 URGI_Best IWGSC_N
BLAST, e-value	9e-30 6DS_2061905 Best IWGSC match
DNA	cgcgccgccatggccgccagaacctcaagctgagatctgcaccgacgggc Rcagcccaagaaatgggtcttgccacggcagtcctcggagcagaaatctg c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.