Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Tdurum_contig42655_703

[Submit comment/correction]

Sequence	Tdurum_contig42655_703
Contig	6BS_2955016
Probe	Tdurum_contig42655_703
DNA Homology	6BS_2955016 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 6BS_2955016 Best IWGSC match
DNA	gcagtgatggacaccttgagcagtatggtgcaaaatgtggatgtgccaca Ragggggggccaaggtggttttgacttgtccagtatgatgcagcagatga t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.