Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 6DS_2058336

[Submit comment/correction]

Sequence	RFL_Contig5885_435
Contig	6DS_2058336
Probe	RFL_Contig5885_435
DNA Homology	6DS_2058336 Best IWGSC match 143 5e-32 URGI_Best IWGSC_N
BLAST, e-value	5e-32 6DS_2058336 Best IWGSC match
DNA	agggtgtcatcatggccatcgagcatccaggcatcgctgcaggctcagcc Rcggttgcaggaatcgtgctgctcaaaaggccaaggagctacctaatcca a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.