Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c53183_1135

[Submit comment/correction]

Sequence	RAC875_c53183_1135
Contig	7BL_5892418 2BL_8056915
Species	Triticum aestivum
Probe	RAC875_c53183_1135
DNA Homology	7BL_5892418 Best IWGSC match 139 5e-31 URGI_Best IWGSC_N
BLAST, e-value	5e-31 7BL_5892418 Best IWGSC match
DNA	tcaccgaccaaacctcgccggataagagagaggccaacctccctaacccc Rcagtgccaccggccggagggagcactcgcccccgc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.