Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 6BS_903052

[Submit comment/correction]

Sequence	BS00027942_51
Contig	6BS_903052
Probe	BS00027942_51
DNA Homology	6BS_903052 Best IWGSC match 69 9e-10 URGI_Best IWGSC_N
BLAST, e-value	9e-10 6BS_903052 Best IWGSC match
DNA	tccacactctctttgcatgcgccgaccgtattgtagatgtgcatgaagtc Rcggaacgcgaccctccggtacctcgccgacctgccctcgacgacgagct c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.