Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 6BS_3018188

[Submit comment/correction]

Sequence	Kukri_c54773_76
Contig	6BS_3018188
Probe	Kukri_c54773_76
DNA Homology	6BS_3018188 Best IWGSC match 174 1.99993e-41 URGI_Best IWGSC_N
BLAST, e-value	1.99993e-41 6BS_3018188 Best IWGSC match
DNA	aaaatcataccaatttgcagtcatgccatcctcactggtaattgccctta Ragcaaccacatgggagtgagttctctggtcaccctggaccccaactgtt t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.