Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c26450_575

[Submit comment/correction]

Sequence	RAC875_c26450_575
Contig	6BS_2953191
Probe	RAC875_c26450_575
DNA Homology	6BS_2953191 Best IWGSC match 161 1e-37 URGI_Best IWGSC_N
BLAST, e-value	1e-37 6BS_2953191 Best IWGSC match
DNA	aaatcccgacaaccgctaccttggatgcatccaccagtccttccttgatc Rcgtggtctagcgccgcaagacaatcttggacatcctgtgatccaacctt c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.