Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ex_c8011_13584847

[Submit comment/correction]

Sequence	wsnp_Ex_c8011_13584847
Contig	6BS_894701
Probe	wsnp_Ex_c8011_13584847
DNA Homology	6BS_894701 Best IWGSC match 344 0 URGI_Best IWGSC_N
BLAST, e-value	0 6BS_894701 Best IWGSC match
DNA	gccaacaactctcgcagacaattgattcatatattgcagatgagagagtg ggactagctgagcctgcagatggactggagctgtacctgtgccctcctca Rgggaaaactgtggagattctctcccagcacctgccaaaggagcacttgg gtggtctcgctgtggcagaaacgtcgataattggaatcgtcgtctggcgg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.