Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 6AS_4325093

[Submit comment/correction]

Sequence	GENE-4142_711
Contig	6AS_4325093
Probe	GENE-4142_711
DNA Homology	6AS_4325093 Best IWGSC match 172 5.99994e-41 URGI_Best IWGSC_N
BLAST, e-value	5.99994e-41 6AS_4325093 Best IWGSC match
DNA	ggtgcatgtgcaagaaaaggagccaactctcgaccccaacgcaagtaacc Rtcagtaccctgcgaaacrtcaaaggaagagtgacaattcgtcagtc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.