Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c3795_198

[Submit comment/correction]

Sequence	Excalibur_c3795_198
Contig	6BS_742746
Probe	Excalibur_c3795_198
DNA Homology	6BS_742746 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 6BS_742746 Best IWGSC match
DNA	tgagagccactcacaaggaactcgctcacaacttgtgccactgcatcgag Rcattgcagaatgatttcccaagggaccctacgacggcgccgaatttctg g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.