Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: JD_c15653_302

[Submit comment/correction]

Sequence	JD_c15653_302
Contig	6DS_2100121
Probe	JD_c15653_302
DNA Homology	6DS_2100121 Best IWGSC match 111 1e-22 URGI_Best IWGSC_N
BLAST, e-value	1e-22 6DS_2100121 Best IWGSC match
DNA	atactggatgcttcctggtacatgccacacgagagcagggacgcatggca Rgaataccaggtggctcatattcctggcgcgctgtacttcgacatcgatg g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.