Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c14575_323

[Submit comment/correction]

Sequence	BobWhite_c14575_323
Contig	6BS_2949026
Chromosome	6B
Probe	BobWhite_c14575_323
Reference	Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
DNA Homology	6BS_2949026 Best IWGSC match 161 1e-37 URGI_Best IWGSC_N
BLAST, e-value	1e-37 6BS_2949026 Best IWGSC match
DNA	caagtcacttcggagggtgaaagcgcatctgggtcaaagtttgtccgagg Rggtgttatcgaccccaatgccaagctgagagctgattctgaaggtggaa a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.