Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c22907_61

[Submit comment/correction]

Sequence	RAC875_c22907_61
Contig	6BS_646898
Probe	RAC875_c22907_61
DNA Homology	6BS_646898 Best IWGSC match 180 3.9937e-43 URGI_Best IWGSC_N
BLAST, e-value	3.9937e-43 6BS_646898 Best IWGSC match
DNA	cggtggttggtcaaggggcaaacaccactgatgcagctcctggagaaacc Rgcttctctggaatcccaaacacagcaccattagatcttttcccacaggg g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.