Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Kukri_c3983_670

[Submit comment/correction]

Sequence	Kukri_c3983_670
Contig	6DS_2071480
Probe	Kukri_c3983_670
DNA Homology	6DS_2071480 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 6DS_2071480 Best IWGSC match
DNA	tcctccagcctaacgtctgcgatgtctccatattgtgaggcaacaagccc Rtagagtgtccatgccaccgggcatgcccatgagtaccacctccaccata t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.