Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_BF291478B_Ta_2_1

[Submit comment/correction]

Sequence	wsnp_BF291478B_Ta_2_1
Contig	6BS_2202063
Probe	wsnp_BF291478B_Ta_2_1
DNA Homology	6BS_2202063 Best IWGSC match 220 0 URGI_Best IWGSC_N
BLAST, e-value	0 6BS_2202063 Best IWGSC match
DNA	GCCCATCTAACAAGAGACTGTTCTGACCTCTCTCTAGAACTGCAACAGCC GTCCAAAGGTYAATTTACTAATTATAAGGTGTAACGCACCAGAATCAGAA TATAAGCTAGAGGGTATATAC

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.