Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BS00103275_51

[Submit comment/correction]

Sequence	BS00103275_51
Contig	6BL_4403379
Probe	BS00103275_51
DNA Homology	6BL_4403379 Best IWGSC match 69 9e-10 URGI_Best IWGSC_N
BLAST, e-value	9e-10 6BL_4403379 Best IWGSC match
DNA	tgaaccagctcaccggcccgatcccctcatccttctcgtgcctcagcagc Rtcgagcagctcaacctggccgggaaccgcctgtacgggcaggttcctga t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.