Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 6DL_3328694

[Submit comment/correction]

Sequence	BS00054287_51
Contig	6DL_3328694
Probe	BS00054287_51
DNA Homology	6DL_3328694 Best IWGSC match 167 3e-39 URGI_Best IWGSC_N
BLAST, e-value	3e-39 6DL_3328694 Best IWGSC match
DNA	cgggcgatggagcagccaacctgaacggccaccggatccgagactcgcca Ragcagatcgaggcagatttagaccatgccgtccgtgggaccccggctcc g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.