Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BS00022462_51

[Submit comment/correction]

Sequence	BS00022462_51
Contig	6DS_2106017
Probe	BS00022462_51
DNA Homology	6DS_2106017 Best IWGSC match 124 2e-26 URGI_Best IWGSC_N
BLAST, e-value	2e-26 6DS_2106017 Best IWGSC match
DNA	ggtgcagcaggctcgtccgccgccgcgggggcatcccctgcggcaggtgc Rtcgcccctgtcctcctgcatcgagcttgattcagccggagcatcggccg c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.