Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_BF428573B_Td_2_2

[Submit comment/correction]

Sequence	wsnp_BF428573B_Td_2_2
Contig	6DL_3256991
Probe	wsnp_BF428573B_Td_2_2
DNA Homology	6DL_3256991 Best IWGSC match 182 9.94922e-44 URGI_Best IWGSC_N
BLAST, e-value	9.94922e-44 6DL_3256991 Best IWGSC match
DNA	TCACGCCGCGCTCAGATCCGCTCGCAGGAATCATGGCATTCGTTTTTCTT CTGGTGATGCRGGTGGTAGCAGCAGCAGCGCAAACCCTTCTCGCAACGAC CACGTGTTGAAGAGAAATCAG

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.