Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TA004372-0730

[Submit comment/correction]

Sequence	TA004372-0730
Contig	6BL_4263183
Probe	TA004372-0730
DNA Homology	6BL_4263183 Best IWGSC match 97 2e-18 URGI_Best IWGSC_N
BLAST, e-value	2e-18 6BL_4263183 Best IWGSC match
DNA	caccgtcactatctaccttgtcatccaaagtaccaacagcatcggatgcc Raga

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.