Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 6AL_5777106

[Submit comment/correction]

Sequence	BobWhite_rep_c65533_249
Contig	6AL_5777106
Probe	BobWhite_rep_c65533_249
DNA Homology	6AL_5777106 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 6AL_5777106 Best IWGSC match
DNA	acactcagatggcctctgcttgctattgaagcatcaggctttggagtacc Rttgcgtgctgcttcctgctgctctagtgccttggactcaaagtattcca g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.