Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ex_c12433_19827016

[Submit comment/correction]

Sequence	wsnp_Ex_c12433_19827016
Contig	6BL_4294925
Probe	wsnp_Ex_c12433_19827016
DNA Homology	6BL_4294925 Best IWGSC match 169 2e-39 URGI_Best IWGSC_N
BLAST, e-value	2e-39 6BL_4294925 Best IWGSC match
DNA	ctgcaactcaagcaaacaagaacacaaatgccaatgaaggagagaattgg ctgaaaagatacgtcgagtactgccgcaacacatgtagaccacgactctc Mgaaaaagcagcagagatgctgcagaataaatatgttgagatcagacaga aaatgagacaacaatcccatgagacaggaagagctgcagccatacccatc a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.