Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 6AL_5833156

[Submit comment/correction]

Sequence	Tdurum_contig56658_269
Contig	6AL_5833156
Probe	Tdurum_contig56658_269
DNA Homology	6AL_5833156 Best IWGSC match 102 9e-20 URGI_Best IWGSC_N
BLAST, e-value	9e-20 6AL_5833156 Best IWGSC match
DNA	cagaggaatgctgccagcgctaaccgctcaccgagagcggcggctttcag Rgttcaggcagccaagcttcctgccggagtccaggtgccaaaggcgcaac c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.