Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c7810_102

[Submit comment/correction]

Sequence	BobWhite_c7810_102
Contig	6BL_4365248
Probe	BobWhite_c7810_102
DNA Homology	6BL_4365248 Best IWGSC match 152 8e-35 URGI_Best IWGSC_N
BLAST, e-value	8e-35 6BL_4365248 Best IWGSC match
DNA	agtatcagcgcctgcacctcgtggacgttggtctcgatgacctggcagac Rgagagggagatcatggaggtcttgccggtgccggactgggcctgggcga t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.