Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c24832_1158

[Submit comment/correction]

Sequence	RAC875_c24832_1158
Contig	6AL_5726621
Probe	RAC875_c24832_1158
DNA Homology	6AL_5726621 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 6AL_5726621 Best IWGSC match
DNA	ttgcttagatgagcaaacctctgcgcaccgatcccaatttcgtcatcatc Ratgtgctgaagctggagattgttttccatggagtatggaaccaatgcat c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.