Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c6108_541

[Submit comment/correction]

Sequence	Excalibur_c6108_541
Contig	6BL_4399689
Probe	Excalibur_c6108_541
DNA Homology	6BL_4399689 Best IWGSC match 132 1e-28 URGI_Best IWGSC_N
BLAST, e-value	1e-28 6BL_4399689 Best IWGSC match
DNA	agtattgcgtaagagcttgcaatcagagcctgggcagaaactgctaaggc Rtctgcaagcagagatacagcaagccatacttgcaaacaaatctgatgag c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.