Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: tplb0060j17_363

[Submit comment/correction]

Sequence	tplb0060j17_363
Contig	6AS_4404183
Probe	tplb0060j17_363
DNA Homology	6AS_4404183 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 6AS_4404183 Best IWGSC match
DNA	aagttttggatgccactgttaacccctgcagcaccagccatgttgccgcc Rtaggttgggtagaagccgctgccgctgccaccagcgctgcttcccatgc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.