Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c99104_213

[Submit comment/correction]

Sequence	Excalibur_c99104_213
Contig	6BS_2964434
Probe	Excalibur_c99104_213
DNA Homology	6BS_2964434 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 6BS_2964434 Best IWGSC match
DNA	gccatgaggggcctctcgacgccgtacttggtgtggttggccacgaggtc Rtacttgatggggtacaggtcggtgaagacgatggcggcgtcggccatgc g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.