Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ex_c1690_3206784

[Submit comment/correction]

Sequence	wsnp_Ex_c1690_3206784
Contig	6DL_2911232
Probe	wsnp_Ex_c1690_3206784
DNA Homology	6DL_2911232 Best IWGSC match 213 0 URGI_Best IWGSC_N
BLAST, e-value	0 6DL_2911232 Best IWGSC match
DNA	agaggactaacgtccctgggatgaagcagcgtcctccacgcggattcaat ccctatcatgcctacccctatagatcatacggggcaccgtatttcccgcc Rtatggatatgggagagttcccagattccgccggccgacacgctacaggc cgtacttctgagaggacaaggctttcatgaagttcaacgcaatgccagta g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.