Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CAP11_rep_c6864_291

[Submit comment/correction]

Sequence	CAP11_rep_c6864_291
Contig	6DL_3325102
Probe	CAP11_rep_c6864_291
DNA Homology	6DL_3325102 Best IWGSC match 172 7.00005e-41 URGI_Best IWGSC_N
BLAST, e-value	7.00005e-41 6DL_3325102 Best IWGSC match
DNA	tcgcccctgacgagatcacgccggatgatccacatgaactgcctgccgct Rttcgccagcccccacgcgaactccaggagctgctccttggtcatgaccg t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.