Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CAP8_c5341_74

[Submit comment/correction]

Sequence	CAP8_c5341_74
Contig	6BL_4355680
Probe	CAP8_c5341_74
DNA Homology	6BL_4355680 Best IWGSC match 163 4e-38 URGI_Best IWGSC_N
BLAST, e-value	4e-38 6BL_4355680 Best IWGSC match
DNA	ggccggggtccgtcggcggcggctgtaaagtacggcagcgtgctgctccc Mgacatcacgcggcccaacatcgtggaggcgctgctcatggtgtccctgc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.