Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 6DL_3256722

[Submit comment/correction]

Sequence	RFL_Contig2615_982
Contig	6DL_3256722
Probe	RFL_Contig2615_982
DNA Homology	6DL_3256722 Best IWGSC match 135 9e-30 URGI_Best IWGSC_N
BLAST, e-value	9e-30 6DL_3256722 Best IWGSC match
DNA	gattcatcatcactgctattcttgagccggatggagaggcaaccaacggc Rtgaccaggcacaagctcccaaaaccgagcctgggatacctcagagacat c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.