Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Kukri_c38025_633

[Submit comment/correction]

Sequence	Kukri_c38025_633
Contig	6DL_3298072
Probe	Kukri_c38025_633
DNA Homology	6DL_3298072 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 6DL_3298072 Best IWGSC match
DNA	aaattctctaggtcgagggtagtgagaccaccaaatgcacttgggcaggc Rtcaaagaacaacatgaattttctcccagcggtgaccagatcatcctcgt c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.