Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 7DS_1844676

[Submit comment/correction]

Sequence	BobWhite_c8796_448
Contig	7DS_1844676
Probe	BobWhite_c8796_448
DNA Homology	7DS_1844676 Best IWGSC match 169 8e-40 URGI_Best IWGSC_N
BLAST, e-value	8e-40 7DS_1844676 Best IWGSC match
DNA	tggcatttctggttgatgagggcggcggagcgggagacgagctcgatgtc Rttgccgtcgaggacgatctcatccttgaccttctcggaccgcaagatgg t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.