Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c66882_301

[Submit comment/correction]

Sequence	RAC875_c66882_301
Contig	7AS_4246804
Probe	RAC875_c66882_301
DNA Homology	7AS_4246804 Best IWGSC match 163 4e-38 URGI_Best IWGSC_N
BLAST, e-value	4e-38 7AS_4246804 Best IWGSC match
DNA	agtccaaatggaggaatgccaaggacgatggcgctggcatccatacctct Rctccgcgtgtgcctcaacctgcgccccgcacaaccccactggccggtgg t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.