Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CAP11_c1661_59

[Submit comment/correction]

Sequence	CAP11_c1661_59
Contig	7AS_4047567
Probe	CAP11_c1661_59
DNA Homology	7AS_4047567 Best IWGSC match 141 2e-31 URGI_Best IWGSC_N
BLAST, e-value	2e-31 7AS_4047567 Best IWGSC match
DNA	acaggtcgatacggaataccggctgccccagcatacctagtaggggacac Rtaccttctcggagcacttctcaacgcccccggccgtaaggtaccactct c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.