Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 7AS_4254431

[Submit comment/correction]

Sequence	BobWhite_c11354_376
Contig	7AS_4254431
Probe	BobWhite_c11354_376
DNA Homology	7AS_4254431 Best IWGSC match 126 5e-27 URGI_Best IWGSC_N
BLAST, e-value	5e-27 7AS_4254431 Best IWGSC match
DNA	taattctgacgcctgcctgccaaagcagacggatgctactccttgaaccc Raaatcgtcaaatatcccctcggcgtcgtttatcccatatgcaacacaat a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.