Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 7AS_4182395

[Submit comment/correction]

Sequence	IAAV1971
Contig	7AS_4182395
Probe	IAAV1971
DNA Homology	7AS_4182395 Best IWGSC match 158 4e-36 URGI_Best IWGSC_N
BLAST, e-value	4e-36 7AS_4182395 Best IWGSC match
DNA	nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncc tcgcctagcttgtcaaagtcaaagtatctattttttgatccattgctacc Rgcaagcttagatggatgggactctattgggacacnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn n

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.