Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 1BL_3842900

[Submit comment/correction]

Sequence	RFL_Contig220_101
Contig	1BL_3842900
Probe	RFL_Contig220_101
DNA Homology	1BL_3842900 Best IWGSC match 172 7.00005e-41 URGI_Best IWGSC_N
BLAST, e-value	7.00005e-41 1BL_3842900 Best IWGSC match
DNA	ctccgtcgcagcccaagtcgggcctcttcgtgggcatcaacaagggccac Rtcgtcaccaagcgcgagctgccgccacgcccgtccgaccgcaaggggaa a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.